ID: 1073287433_1073287440

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1073287433 1073287440
Species Human (GRCh38) Human (GRCh38)
Location 10:102397250-102397272 10:102397294-102397316
Sequence CCTCAGGAAGAAAGAACTGCATG CTTCTCAGATTTAACAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 306} {0: 1, 1: 0, 2: 0, 3: 14, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!