ID: 1073325949_1073325967

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1073325949 1073325967
Species Human (GRCh38) Human (GRCh38)
Location 10:102644079-102644101 10:102644119-102644141
Sequence CCCTCGGCGCGGCCGCCCTCGCC CCGGGCTCCGGCCCCTGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 334} {0: 1, 1: 0, 2: 1, 3: 19, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!