ID: 1073326148_1073326155

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1073326148 1073326155
Species Human (GRCh38) Human (GRCh38)
Location 10:102644809-102644831 10:102644857-102644879
Sequence CCTGGAGAAGAACCTGAAGCTCA CCTGCACGTGGAGAAGCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 328} {0: 1, 1: 0, 2: 2, 3: 55, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!