ID: 1073336515_1073336523

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1073336515 1073336523
Species Human (GRCh38) Human (GRCh38)
Location 10:102714290-102714312 10:102714310-102714332
Sequence CCTCCTCCTCCTCCTCCTCCTGC TGCTGCCTCCCCCGTTACCAGGG
Strand - +
Off-target summary {0: 37, 1: 2424, 2: 6754, 3: 13394, 4: 22576} {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!