ID: 1073336517_1073336523

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1073336517 1073336523
Species Human (GRCh38) Human (GRCh38)
Location 10:102714296-102714318 10:102714310-102714332
Sequence CCTCCTCCTCCTCCTGCTGCCTC TGCTGCCTCCCCCGTTACCAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 229, 3: 2512, 4: 10356} {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!