ID: 1073338669_1073338679

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1073338669 1073338679
Species Human (GRCh38) Human (GRCh38)
Location 10:102729236-102729258 10:102729263-102729285
Sequence CCAGCCGACTTTCTCCCTGAAGC GGTTTGGCCCTCAGCCGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 125} {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!