ID: 1073364502_1073364514

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1073364502 1073364514
Species Human (GRCh38) Human (GRCh38)
Location 10:102927499-102927521 10:102927551-102927573
Sequence CCTGTAATCCCGGCACTTTGGGA GGAGTTCCAGACTGACAGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!