ID: 1073551234_1073551239

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1073551234 1073551239
Species Human (GRCh38) Human (GRCh38)
Location 10:104403618-104403640 10:104403671-104403693
Sequence CCTAACTCCAACTTTTTATATAA AGATAGGATATTCAAACGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 36, 4: 457} {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!