ID: 1073577991_1073578007

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1073577991 1073578007
Species Human (GRCh38) Human (GRCh38)
Location 10:104641242-104641264 10:104641292-104641314
Sequence CCGGCGCGCGCACACCCCCCGCG ACACTCGGCAGCCCGAGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 212} {0: 1, 1: 0, 2: 1, 3: 4, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!