ID: 1074073548_1074073555 |
View in Genome Browser |
Spacer: 9 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1074073548 | 1074073555 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 10:110098783-110098805 | 10:110098815-110098837 |
Sequence | CCACGCCCAACTAATTTTTTGTA | AAGGCGGGGTTTCACTATGTTGG |
Strand | - | + |
Off-target summary | {0: 187, 1: 8755, 2: 34498, 3: 46231, 4: 61532} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |