ID: 1074073548_1074073556

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1074073548 1074073556
Species Human (GRCh38) Human (GRCh38)
Location 10:110098783-110098805 10:110098820-110098842
Sequence CCACGCCCAACTAATTTTTTGTA GGGGTTTCACTATGTTGGCCAGG
Strand - +
Off-target summary {0: 187, 1: 8755, 2: 34498, 3: 46231, 4: 61532} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!