ID: 1074377547_1074377554

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1074377547 1074377554
Species Human (GRCh38) Human (GRCh38)
Location 10:112951741-112951763 10:112951772-112951794
Sequence CCCGCTCGTGGCCCAGGAGGCCC CCAAACTTTTCTGCCTTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 38, 4: 322} {0: 1, 1: 0, 2: 4, 3: 48, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!