ID: 1074377547_1074377555

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1074377547 1074377555
Species Human (GRCh38) Human (GRCh38)
Location 10:112951741-112951763 10:112951777-112951799
Sequence CCCGCTCGTGGCCCAGGAGGCCC CTTTTCTGCCTTTTGTGGACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 38, 4: 322} {0: 1, 1: 0, 2: 3, 3: 30, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!