ID: 1074512068_1074512075

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1074512068 1074512075
Species Human (GRCh38) Human (GRCh38)
Location 10:114122636-114122658 10:114122650-114122672
Sequence CCCCATTCTCCTCACCATATATT CCATATATTCAGAGGGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 421} {0: 1, 1: 0, 2: 2, 3: 30, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!