ID: 1074756505_1074756517

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1074756505 1074756517
Species Human (GRCh38) Human (GRCh38)
Location 10:116627804-116627826 10:116627830-116627852
Sequence CCACAGCCTGGGCGCGCACACGG CGGAGGCGGGCAGGAGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 196} {0: 1, 1: 0, 2: 1, 3: 95, 4: 889}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!