ID: 1074831915_1074831919

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1074831915 1074831919
Species Human (GRCh38) Human (GRCh38)
Location 10:117255286-117255308 10:117255302-117255324
Sequence CCTTCGGGAGTGTGCTCTATGAG CTATGAGTTTGTGGGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50} {0: 1, 1: 0, 2: 2, 3: 35, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!