ID: 1074839415_1074839424

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1074839415 1074839424
Species Human (GRCh38) Human (GRCh38)
Location 10:117334224-117334246 10:117334257-117334279
Sequence CCTGTAATGTTGGGCTTCATGCC GGAGGTTGAAGCTGGTGGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!