ID: 1074890880_1074890886

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1074890880 1074890886
Species Human (GRCh38) Human (GRCh38)
Location 10:117735732-117735754 10:117735751-117735773
Sequence CCTTAACCTCTCTGGCCTCCCAG CCAGCTGTAAATGGAGTTAACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!