ID: 1074993655_1074993656

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1074993655 1074993656
Species Human (GRCh38) Human (GRCh38)
Location 10:118735844-118735866 10:118735891-118735913
Sequence CCAAATTTAAAAGGCTAAATTAT CTAGATAATCAGAACAGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 67, 4: 624} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!