ID: 1075042979_1075042986

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1075042979 1075042986
Species Human (GRCh38) Human (GRCh38)
Location 10:119123373-119123395 10:119123390-119123412
Sequence CCTCTTCATTTCCTTCTCAGGAA CAGGAAGAGGAGAAGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 473} {0: 1, 1: 3, 2: 14, 3: 223, 4: 1746}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!