ID: 1075520649_1075520653

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1075520649 1075520653
Species Human (GRCh38) Human (GRCh38)
Location 10:123141758-123141780 10:123141781-123141803
Sequence CCTTTCTGCATCACCCAAAGAGA CACACATGGAAACAACACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 267} {0: 1, 1: 0, 2: 5, 3: 36, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!