ID: 1075748381_1075748391

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1075748381 1075748391
Species Human (GRCh38) Human (GRCh38)
Location 10:124743776-124743798 10:124743819-124743841
Sequence CCTGCATCAGGGGCGAGACCGAG CCCAACCCAAAGGCGAAACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!