ID: 1076420204_1076420218

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1076420204 1076420218
Species Human (GRCh38) Human (GRCh38)
Location 10:130326090-130326112 10:130326138-130326160
Sequence CCACAGGTCTGACCTCTGGAGGC CTGTGGGGTTGGAGGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 11, 3: 191, 4: 1461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!