ID: 1076429679_1076429686

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1076429679 1076429686
Species Human (GRCh38) Human (GRCh38)
Location 10:130393028-130393050 10:130393065-130393087
Sequence CCCAAGTACATCTGTGTAGCCAG GGACAGGCAAGGTGATGCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 51, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!