ID: 1076480726_1076480740

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1076480726 1076480740
Species Human (GRCh38) Human (GRCh38)
Location 10:130783691-130783713 10:130783732-130783754
Sequence CCCGCCTTGCAGAAGGGGCCGAG TCCACCGGGGCATCTGTGTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!