ID: 1076554274_1076554301

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1076554274 1076554301
Species Human (GRCh38) Human (GRCh38)
Location 10:131311785-131311807 10:131311835-131311857
Sequence CCGCCCGCGCCGCCGCCGCCCCC CCGCCCGCGCCCCTCCCCGCCGG
Strand - +
Off-target summary {0: 2, 1: 30, 2: 197, 3: 2147, 4: 5279} {0: 1, 1: 1, 2: 5, 3: 84, 4: 617}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!