ID: 1076685927_1076685938

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1076685927 1076685938
Species Human (GRCh38) Human (GRCh38)
Location 10:132198500-132198522 10:132198539-132198561
Sequence CCACAGCACACCCGAGCCAACTC GCCTGGGGCTGTGCTGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 155} {0: 1, 1: 1, 2: 2, 3: 70, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!