ID: 1076687351_1076687366

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1076687351 1076687366
Species Human (GRCh38) Human (GRCh38)
Location 10:132204111-132204133 10:132204156-132204178
Sequence CCCTCCTGCCCGCTGTCTGCCCA CCTTCAAGACAGTGGCACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 421} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!