ID: 1076816958_1076816970

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1076816958 1076816970
Species Human (GRCh38) Human (GRCh38)
Location 10:132919803-132919825 10:132919854-132919876
Sequence CCGAGTGACAGCAGTGACAGGCG CGTGGCTGTCATCACAGGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!