ID: 1076827573_1076827584

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1076827573 1076827584
Species Human (GRCh38) Human (GRCh38)
Location 10:132977012-132977034 10:132977057-132977079
Sequence CCAGCAGGTGGGTAACCCTCACT CCTCGCGTCCCAGGCAGTCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!