ID: 1076905241_1076905254

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1076905241 1076905254
Species Human (GRCh38) Human (GRCh38)
Location 10:133357991-133358013 10:133358010-133358032
Sequence CCCTTCAGCGCCACCATGGCCCG CCCGGCAGACGGGGCGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 94} {0: 1, 1: 0, 2: 3, 3: 28, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!