ID: 1076910884_1076910892

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1076910884 1076910892
Species Human (GRCh38) Human (GRCh38)
Location 10:133388762-133388784 10:133388789-133388811
Sequence CCCTGCTCCATCAGTGGTTCCTT AGAAACGCGGGCGGAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 175} {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!