ID: 1076922231_1076922243

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1076922231 1076922243
Species Human (GRCh38) Human (GRCh38)
Location 10:133460001-133460023 10:133460027-133460049
Sequence CCGCGCCCTGAGCGCCCTGGGGG CACACTTCGGAGCCGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 258} {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!