ID: 1076922993_1076923000

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1076922993 1076923000
Species Human (GRCh38) Human (GRCh38)
Location 10:133465285-133465307 10:133465307-133465329
Sequence CCGCTGCTCCGGGCGCGTGGAGC CTCTGGCACGCGGGCTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 108} {0: 1, 1: 0, 2: 1, 3: 6, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!