ID: 1076936982_1076936985

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1076936982 1076936985
Species Human (GRCh38) Human (GRCh38)
Location 10:133572206-133572228 10:133572220-133572242
Sequence CCTGACATCGGAAGACCCCAGGA ACCCCAGGATGCTGGGTCAGCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 3, 3: 26, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!