ID: 1077009599_1077009606

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1077009599 1077009606
Species Human (GRCh38) Human (GRCh38)
Location 11:374326-374348 11:374339-374361
Sequence CCCAGGGAGGTGGCTGTGGGGAT CTGTGGGGATGGACGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 440} {0: 1, 1: 0, 2: 1, 3: 54, 4: 605}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!