ID: 1077021582_1077021604

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1077021582 1077021604
Species Human (GRCh38) Human (GRCh38)
Location 11:419438-419460 11:419491-419513
Sequence CCACCCCCAGGCCCCAGCCTCAC CATTCCCAGGAGAAAGGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 20, 3: 261, 4: 2003} {0: 1, 1: 0, 2: 1, 3: 26, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!