ID: 1077028427_1077028437

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1077028427 1077028437
Species Human (GRCh38) Human (GRCh38)
Location 11:451991-452013 11:452023-452045
Sequence CCATCAGGTGCCCTGCCACACCC GTCCTCCCGCAGCACAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 18, 4: 302} {0: 1, 1: 0, 2: 2, 3: 24, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!