ID: 1077053146_1077053154

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1077053146 1077053154
Species Human (GRCh38) Human (GRCh38)
Location 11:576684-576706 11:576704-576726
Sequence CCGCGGGGCGAGGCCTGCGCCGC CGCGCTGGCCGCGGGCCGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 186} {0: 1, 1: 0, 2: 5, 3: 53, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!