ID: 1077059567_1077059579

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1077059567 1077059579
Species Human (GRCh38) Human (GRCh38)
Location 11:611873-611895 11:611913-611935
Sequence CCATGCCCGGGGAGCTGTCGGGA GCATCACCATGCCTGCCGTCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 119} {0: 1, 1: 0, 2: 2, 3: 9, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!