ID: 1077101898_1077101905

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1077101898 1077101905
Species Human (GRCh38) Human (GRCh38)
Location 11:826123-826145 11:826153-826175
Sequence CCTTGGTCTCAAGGTCCTGTCCT CAGCCTTTTGTGGTTCAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!