ID: 1077111053_1077111058

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1077111053 1077111058
Species Human (GRCh38) Human (GRCh38)
Location 11:862403-862425 11:862420-862442
Sequence CCGTGGGATCTAGCAGGACTCTG ACTCTGGGTGGTTCTGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 174} {0: 1, 1: 1, 2: 8, 3: 87, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!