ID: 1077140873_1077140879

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1077140873 1077140879
Species Human (GRCh38) Human (GRCh38)
Location 11:1024334-1024356 11:1024359-1024381
Sequence CCAAGATGCCGCTGCCGCTAACC GGCCACTGCAGTCCCACCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59} {0: 1, 1: 0, 2: 4, 3: 45, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!