ID: 1077174785_1077174794

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1077174785 1077174794
Species Human (GRCh38) Human (GRCh38)
Location 11:1183969-1183991 11:1184003-1184025
Sequence CCCACGGAGCCCAGCACATCCTC AGCTTTGCACCTGGACCGAGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 190} {0: 2, 1: 0, 2: 0, 3: 8, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!