ID: 1077200647_1077200657

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1077200647 1077200657
Species Human (GRCh38) Human (GRCh38)
Location 11:1305837-1305859 11:1305889-1305911
Sequence CCTCTCTGACGGCACCGCGGTGG AGATCTCACTGCAGAAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 44} {0: 1, 1: 0, 2: 0, 3: 24, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!