ID: 1077219963_1077219983

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1077219963 1077219983
Species Human (GRCh38) Human (GRCh38)
Location 11:1411462-1411484 11:1411500-1411522
Sequence CCTTCCTCCCTCTGCTCCCCAAG CCCAGCGGTGGGCAGGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 187, 4: 1512} {0: 1, 1: 0, 2: 10, 3: 97, 4: 710}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!