ID: 1077223470_1077223478

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1077223470 1077223478
Species Human (GRCh38) Human (GRCh38)
Location 11:1427435-1427457 11:1427471-1427493
Sequence CCCGTGTTAACGTGCTAGTCTGC GCATCCTCGTGGCATACCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 231} {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!