ID: 1077262561_1077262568

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1077262561 1077262568
Species Human (GRCh38) Human (GRCh38)
Location 11:1630498-1630520 11:1630534-1630556
Sequence CCCTGCTGCTGCCAGTCCAGCTG TGCTGCCAGTGTAAGATCTGAGG
Strand - +
Off-target summary {0: 5, 1: 8, 2: 17, 3: 53, 4: 495} {0: 6, 1: 2, 2: 2, 3: 3, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!