ID: 1077299742_1077299755

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1077299742 1077299755
Species Human (GRCh38) Human (GRCh38)
Location 11:1841437-1841459 11:1841489-1841511
Sequence CCTGCCCTCTCCTCCACAGGAGC AAGAACATCGAGGAGAAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 528} {0: 1, 1: 0, 2: 0, 3: 5, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!