ID: 1077305376_1077305383

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1077305376 1077305383
Species Human (GRCh38) Human (GRCh38)
Location 11:1866588-1866610 11:1866601-1866623
Sequence CCTACCCCTGGCCCCCCATAAGC CCCCATAAGCCTCCTCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 341} {0: 1, 1: 1, 2: 3, 3: 43, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!